ralgps2

Ensembl ID:
ENSDARG00000026519
ZFIN ID:
ZDB-GENE-040426-1212
Description:
Ral-A exchange factor RalGPS2 [Source:RefSeq peptide;Acc:NP_956768]
Human Orthologue:
RALGPS2
Human Description:
Ral GEF with PH domain and SH3 binding motif 2 [Source:HGNC Symbol;Acc:30279]
Mouse Orthologue:
Ralgps2
Mouse Description:
Ral GEF with PH domain and SH3 binding motif 2 Gene [Source:MGI Symbol;Acc:MGI:1925505]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11383 Nonsense Available for shipment Available now
sa43404 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43403 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021550 Nonsense 124 586 7 21
ENSDART00000037420   None 564 None 20
ENSDART00000127622 Nonsense 132 594 5 19
Genomic Location:
Chromosome 20 (position 16075313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTTCATGCTCAGACTCTRAAGATCAGAGCAGAAGTKTTGAGCCTCTA[T/A]ATCAGAACAGYAAAGGTAAAAAMACAAAAGTCAGAATGCATACTGTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021550 Essential Splice Site 203 586 9 21
ENSDART00000037420 Essential Splice Site 181 564 8 20
ENSDART00000127622 Essential Splice Site 211 594 7 19
Genomic Location:
Chromosome 20 (position 16061092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGATTACATCAGCAGCCAGAGCATGACATCCTGCATCCCGTATCTGGG[T/A]ATTTCTCCTGCTTTCTCTTCCGCACACATTCAGTCACAACCTTATAGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021550 Nonsense 216 586 10 21
ENSDART00000037420 Nonsense 194 564 9 20
ENSDART00000127622 Nonsense 224 594 8 19
Genomic Location:
Chromosome 20 (position 16015545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTGCAGGAATCTATTTGTCTGATCTGACGTACATTGATTCGGCGTA[T/G]CCCTCCACTGGAAGCATCCTTGAAAACGAACAGCGCTCCAACCTCATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link