ppm1e

Ensembl ID:
ENSDARG00000026499
ZFIN ID:
ZDB-GENE-070326-2
Description:
protein phosphatase 1E [Source:RefSeq peptide;Acc:NP_001018354]
Human Orthologue:
PPM1E
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1E [Source:HGNC Symbol;Acc:19322]
Mouse Orthologue:
Ppm1e
Mouse Description:
protein phosphatase 1E (PP2C domain containing) Gene [Source:MGI Symbol;Acc:MGI:2444096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21762 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21762
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063551 Essential Splice Site 287 633 5 7
Genomic Location (Zv9):
Chromosome 10 (position 33735135)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32836484
KASP Assay ID:
2260-3419.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGGTCAACCGGTGGAGCTAATGAAGCCACACAAACCTGACAGAGAG[G/A]TGAAAAAGCATTATTATTATTATTAGTATCATTATTAGTTGAAGGGCGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link