arhgap12

Ensembl ID:
ENSDARG00000026482
ZFIN ID:
ZDB-GENE-040426-1727
Description:
rho GTPase-activating protein 12 [Source:RefSeq peptide;Acc:NP_957168]
Human Orthologue:
ARHGAP12
Human Description:
Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
Mouse Orthologue:
Arhgap12
Mouse Description:
Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4468 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046959 Essential Splice Site None 817 1 17
ENSDART00000141401 None None 272 None 8

The following transcripts of ENSDARG00000026482 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 28193276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCCAACTAACGGGCATGGCCGCTCCCAGATCCCCCTGAACGCCAGG[T/A]CAGTATGGGCAGTTTCTGCGTTCATTCTTATGCTTCAAAGGCGCATTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lmxhr14j