arhgap12

Ensembl ID:
ENSDARG00000026482
ZFIN ID:
ZDB-GENE-040426-1727
Description:
rho GTPase-activating protein 12 [Source:RefSeq peptide;Acc:NP_957168]
Human Orthologue:
ARHGAP12
Human Description:
Rho GTPase activating protein 12 [Source:HGNC Symbol;Acc:16348]
Mouse Orthologue:
Arhgap12
Mouse Description:
Rho GTPase activating protein 12 Gene [Source:MGI Symbol;Acc:MGI:1922665]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4468 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38897 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa4468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046959 Essential Splice Site None 817 1 17
ENSDART00000141401   None 272 None 8

The following transcripts of ENSDARG00000026482 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 28193276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTCCAACTAACGGGCATGGCCGCTCCCAGATCCCCCTGAACGCCAGG[T/A]CAGTATGGGCAGTTTCTGCGTTCATTCTTATGCTTCAAAGGCGCATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046959 Essential Splice Site 480 817 8 17
ENSDART00000141401   None 272 None 8

The following transcripts of ENSDARG00000026482 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 28277791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGATCCTCTTTACTGTTTGCAAAGGGTCAGGGCAGCGGCACCAGCTGG[G/A]TATGTATTCATGCCAGCTTACAGTGGGGCAAATCTGGAAATGTACCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link