tia1l

Ensembl ID:
ENSDARG00000026476
ZFIN ID:
ZDB-GENE-030131-2167
Description:
TIA1 cytotoxic granule-associated RNA binding protein 1 [Source:RefSeq peptide;Acc:NP_956476]
Human Orthologue:
TIA1
Human Description:
TIA1 cytotoxic granule-associated RNA binding protein [Source:HGNC Symbol;Acc:11802]
Mouse Orthologue:
Tia1
Mouse Description:
cytotoxic granule-associated RNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:107914]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20408 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003957 Nonsense 162 342 7 11
Genomic Location:
Chromosome 5 (position 26182401)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTTTATAGGATGCAGAAAGTGCTATTCAGCAAATGAATGGCCAGTG[G/A]CTGGGCGGCAGACAGATCAGAACAAACTGGGCCACAAGGAAGCCATCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i37y598h