ccr12.2

Ensembl ID:
ENSDARG00000026417
ZFIN ID:
ZDB-GENE-070301-2
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRY7]
Human Orthologue:
XCR1
Human Description:
chemokine (C motif) receptor 1 [Source:HGNC Symbol;Acc:1625]
Mouse Orthologue:
Xcr1
Mouse Description:
chemokine (C motif) receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1346338]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18480 Nonsense Available for shipment Available now
sa12285 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18480
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066872 Nonsense 179 346 2 2
Genomic Location:
Chromosome 24 (position 595721)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCRTCTACGCTGCATCGTTATCTGTGGCYGTCTGGATTWTCAGCCTTCTC[G/T]MAAGCCTCGAATATCTCATCCGTTTCACAGTGGAAGAGTCTCAGATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066872 Nonsense 229 346 2 2
Genomic Location:
Chromosome 24 (position 595873)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAGCAGTTTGTGTTGTTCTTCCTCTTCCCGCTGGTTGTGTTTGTGTA[C/A]WGCTACTCCAKGATAACACTAACCRTCATGCRCACTCGGWTGATRGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ek51obw