anxa5a

Ensembl ID:
ENSDARG00000026406
ZFIN ID:
ZDB-GENE-080220-29
Description:
annexin A5a [Source:RefSeq peptide;Acc:NP_001107054]
Human Orthologue:
ANXA5
Human Description:
annexin A5 [Source:HGNC Symbol;Acc:543]
Mouse Orthologue:
Anxa5
Mouse Description:
annexin A5 Gene [Source:MGI Symbol;Acc:MGI:106008]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa951 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa951
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032342 Essential Splice Site 130 316 6 13
Genomic Location (Zv9):
Chromosome 14 (position 49360593)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 47437831
KASP Assay ID:
554-0856.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGACATGTGAAGAGATTAAAGAGATTGTCAAAGCTTATAAGAAAGG[T/A]AATATTCATTGTGCAGCCACATAATTAGGCTAAAATTTTGTAATTATTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link