si:ch73-60g14.3

Ensembl ID:
ENSDARG00000026403
ZFIN ID:
ZDB-GENE-091204-388
Human Orthologue:
HEPHL1
Human Description:
hephaestin-like 1 [Source:HGNC Symbol;Acc:30477]
Mouse Orthologue:
Hephl1
Mouse Description:
hephaestin-like 1 Gene [Source:MGI Symbol;Acc:MGI:2685355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7219 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41658 Nonsense Mutation detected in F1 DNA During 2017
sa34902 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34901 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Essential Splice Site 9 1091 2 20
ENSDART00000135985   None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24847497)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24446849
KASP Assay ID:
554-4523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGCTGCAGAATWATTTGAGAACCCTAGCTGGGCAGTTGTGTTCTTT[C/T]GGAAACTATGCTTTCTTTCCTGGAGTTTTTGGGAAGCTTGAGCATCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Nonsense 63 1091 2 20
ENSDART00000135985   None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24847333)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24446685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGGATTATGCACCAAGTGGACAGAATCTGATCAATGGGAAGCGTATT[G/T]AAGAGGATGAGTAAGAGATTTATTTATTTATACAAATAAATACATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Essential Splice Site 66 1091 None 20
ENSDART00000135985   None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24842343)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24441695
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTTAAGCTAATAATTCTTCAGAAAACTCTACTTACTTTCTTTTTCCTC[A/C]GGCAGGCATCAGTATTTCTGCAACGTGGGGCTCGGCGGATTGGCAGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064733 Nonsense 483 1091 9 20
ENSDART00000135985   None 197 None 4
Genomic Location (Zv9):
Chromosome 10 (position 24837362)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24436714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTACTGAGGGCAGAGGTTGGAGATACACTTCAGGTGATGTTCATGAAT[A/T]AAGCTGACAGAAACTACAGTATCCAGCCTCATGGACTCCAGTACGACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link