LOC560703

Ensembl ID:
ENSDARG00000026398
Human Orthologue:
MMEL1
Human Description:
membrane metallo-endopeptidase-like 1 [Source:HGNC Symbol;Acc:14668]
Mouse Orthologue:
Mmel1
Mouse Description:
membrane metallo-endopeptidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:1351603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11076 Essential Splice Site Available for shipment Available now
sa9984 Essential Splice Site Available for shipment Available now
sa41905 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11076
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047616 Essential Splice Site 379 765 11 23
Genomic Location:
Chromosome 11 (position 42046825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCTTACCTGGAGAAGCTCAGCGAGGTCCTGTCCAAACACAGCCACAG[G/A]TAATTCTTCACTGCTATCTCAATTATGACCATCCAGAAGAAATAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9984
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047616 Essential Splice Site 410 765 12 23
Genomic Location:
Chromosome 11 (position 42048786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYAGCAGTATGAGCCGTCGCTTCAAAGAYGTGAGAGCGCACTATAGAAAG[G/A]TCAGTCACACACYGAACAAACACAAACTCATGGYATTTCACTCATAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047616 Nonsense 474 765 14 23
Genomic Location:
Chromosome 11 (position 42053487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAAGAAGATTCAGGAAGCTTATGTGGAAACTCTGGAGGAACTGAGCT[G/A]GATGGATGAACAGTCCAAAGTGAAGGCCAGAGAGAAGGTGAGCTTAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link