rfx4

Ensembl ID:
ENSDARG00000026395
ZFIN ID:
ZDB-GENE-040909-2
Description:
Transcription factor RFX4 [Source:UniProtKB/Swiss-Prot;Acc:A2BGA0]
Human Orthologue:
RFX4
Human Description:
regulatory factor X, 4 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9985]
Mouse Orthologue:
Rfx4
Mouse Description:
regulatory factor X, 4 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:1918387]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36604 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031752 Nonsense 675 735 18 18
Genomic Location (Zv9):
Chromosome 18 (position 14921075)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 15366493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTCTAATGAGCGGCTCTCCTCTCCTACACTCCAGTCCAGTGACCCCT[C/T]GATGGCCCGATGTGCCCTCTGCCAACAGCTGTTACTCCAGTCCCACCGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link