aco1

Ensembl ID:
ENSDARG00000026376
ZFIN ID:
ZDB-GENE-031118-76
Description:
cytoplasmic aconitate hydratase [Source:RefSeq peptide;Acc:NP_001030155]
Human Orthologue:
ACO1
Human Description:
aconitase 1, soluble [Source:HGNC Symbol;Acc:117]
Mouse Orthologue:
Aco1
Mouse Description:
aconitase 1 Gene [Source:MGI Symbol;Acc:MGI:87879]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17511 Essential Splice Site Available for shipment Available now
sa27109 Essential Splice Site Mutation detected in F1 DNA During 2015
sa27108 Nonsense Mutation detected in F1 DNA During 2015
sa21154 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa17511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Essential Splice Site 39 896 1 20
Genomic Location:
Chromosome 7 (position 75172360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGACCACAAGTTCTWCAACCTCAGAAARCTTAAAGACCCCAGATATGG[T/A]AAGATCATTTTTGATGCGTGTTTYATTGSATTATTTAACCCTTTAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27109
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Essential Splice Site 164 896 4 20
Genomic Location:
Chromosome 7 (position 75170304)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGATCTTGAATTTGAAAGGAACAGGGAACGCTTTGAGTTCTTAAAGG[T/A]GATTTTGGTTCTTTCTTCACGTCGCATTTAGTAATAATGTTTGCATCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Nonsense 756 896 18 20
Genomic Location:
Chromosome 7 (position 75153474)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTACCTGTTATTTATCTGTGTTTCGTTTGTTGGTGTGTTTTCAGT[T/A]GGATGTGTTTGATGCTGCAGAAAAGTATCAACAGGCTGGTCATCCTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045253 Nonsense 824 896 19 20
Genomic Location:
Chromosome 7 (position 75151910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATTCACCGCAGTAATCTAGTGGGCATGGGTGTAATTCCTCTGGAGTA[T/A]CTGCCGGGAGACTCAGCGGAGAGTTTGGGTCTCAGCGGACGCGAGCGCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study to identify genetic determinants of severe asthma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ew8c2er