csad

Ensembl ID:
ENSDARG00000026348
ZFIN ID:
ZDB-GENE-041114-36
Description:
cysteine sulfinic acid decarboxylase [Source:RefSeq peptide;Acc:NP_001007349]
Human Orthologue:
CSAD
Human Description:
cysteine sulfinic acid decarboxylase [Source:HGNC Symbol;Acc:18966]
Mouse Orthologue:
Csad
Mouse Description:
cysteine sulfinic acid decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2180098]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9430 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024354 Nonsense 524 544 14 14
Genomic Location:
Chromosome 23 (position 36476726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAATGGATGAACACGTCAACTTCTTCCGCATGGTGRTTGTTTCTCCA[C/T]AGCTCACAACCAAAGACATGGATTTCTTCCTTGATGAGATGGAGAAACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k5blsjik