LOC560304

Ensembl ID:
ENSDARG00000026335
Human Orthologue:
SUSD4
Human Description:
sushi domain containing 4 [Source:HGNC Symbol;Acc:25470]
Mouse Orthologue:
Susd4
Mouse Description:
sushi domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2138351]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23176 Nonsense Mutation detected in F1 DNA During 2014
sa23175 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034432 Nonsense 201 484 4 8
Genomic Location:
Chromosome 17 (position 45712423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGAAACTAAGTTCTCTGTGCCTGTTGGAACTGTTGTCCACTATCAGTG[C/A]TTTCCTGGATACAAATTGGAGGGACCTGAACTTCTGGAATGCATGTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034432 Essential Splice Site 472 484 7 8
Genomic Location:
Chromosome 17 (position 45699911)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCATGGAGGAAACCGCATCCACGAGCCCCAGTATAGACATTGCAGACG[G/A]TAAGACTGTGCGCTGCTGACACCTAGTGGTAATACACATACACTGCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3aowft0q