ARHGAP29 (1 of 2)

Ensembl ID:
ENSDARG00000026329
Description:
Rho GTPase activating protein 29 [Source:HGNC Symbol;Acc:30207]
Human Orthologue:
ARHGAP29
Human Description:
Rho GTPase activating protein 29 [Source:HGNC Symbol;Acc:30207]
Mouse Orthologue:
Arhgap29
Mouse Description:
Rho GTPase activating protein 29 Gene [Source:MGI Symbol;Acc:MGI:2443818]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14982 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018037 Nonsense 1318 1344 22 22
Genomic Location:
Chromosome 24 (position 29479075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACAAGNNNNNNTCCACTTCCTGAATCGCCAAGCTCCAGCCCCGAGGAACTCGGA[C/T]AAAATGAGACCAAACCTGTGTACCAGAGACTCCGATCACGGCGCATGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0qhvjley