mmp11a

Ensembl ID:
ENSDARG00000026325
ZFIN ID:
ZDB-GENE-070817-3
Human Orthologue:
MMP11
Human Description:
matrix metallopeptidase 11 (stromelysin 3) [Source:HGNC Symbol;Acc:7157]
Mouse Orthologue:
Mmp11
Mouse Description:
matrix metallopeptidase 11 Gene [Source:MGI Symbol;Acc:MGI:97008]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41243 Nonsense Mutation detected in F1 DNA During 2016
sa8388 Nonsense Mutation detected in F1 DNA During 2016
sa41244 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Nonsense 97 483 2 8
Genomic Location (Zv9):
Chromosome 8 (position 31658785)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30801511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAGGGCCACTGGTCCTAAACGTTGTGGCGTGCCAGACTATCCCGAA[C/T]AGAGAGATGTGCATCTCCGCCAGAAACGATATGTGCTCTTTGGAGGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Nonsense 114 483 2 8
Genomic Location (Zv9):
Chromosome 8 (position 31658838)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30801564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATGTGCATCTCCGCCAGAAACGATATGTGCTCTTTGGAGGACGCTG[G/A]CCAAAAACTGACCTCACCTACAAGTAAGGTGTAMAAAAATTAGAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41244
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Essential Splice Site 356 483 6 8
Genomic Location (Zv9):
Chromosome 8 (position 31668336)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30811062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAGACGCCGCCTATGAAGACAAAAAGGGCAATATCTGGTTCTTTGAAG[G/A]TGGGTGAGTGCAGCGGCACTGGCTGACTCTGGTGATTTGCGGTTGGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Nonsense 405 483 7 8
Genomic Location (Zv9):
Chromosome 8 (position 31670654)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 30813380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTRCGTGTAAAGGAGCACCACAGCCAGCACACATACTTCTTCAAGTCT[G/T]GAAACTACTGGCGTTTGGATCCTCAAGAGAACCGAGTGGAMWCGTCTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link