mmp11a

Ensembl ID:
ENSDARG00000026325
ZFIN ID:
ZDB-GENE-070817-3
Human Orthologue:
MMP11
Human Description:
matrix metallopeptidase 11 (stromelysin 3) [Source:HGNC Symbol;Acc:7157]
Mouse Orthologue:
Mmp11
Mouse Description:
matrix metallopeptidase 11 Gene [Source:MGI Symbol;Acc:MGI:97008]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8388 Nonsense Mutation detected in F1 DNA During 2014
sa16310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Nonsense 114 483 2 8
Genomic Location:
Chromosome 8 (position 31658838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATGTGCATCTCCGCCAGAAACGATATGTGCTCTTTGGAGGACGCTG[G/A]CCAAAAACTGACCTCACCTACAAGTAAGGTGTAMAAAAATTAGAAACAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077280 Nonsense 405 483 7 8
Genomic Location:
Chromosome 8 (position 31670654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTRCGTGTAAAGGAGCACCACAGCCAGCACACATACTTCTTCAAGTCT[G/T]GAAACTACTGGCGTTTGGATCCTCAAGAGAACCGAGTGGAMWCGTCTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qnvizfx