CD97 (1 of 3)

Ensembl ID:
ENSDARG00000026313
Description:
CD97 molecule [Source:HGNC Symbol;Acc:1711]
Human Orthologue:
CD97
Human Description:
CD97 molecule [Source:HGNC Symbol;Acc:1711]
Mouse Orthologue:
Cd97
Mouse Description:
CD97 antigen Gene [Source:MGI Symbol;Acc:MGI:1347095]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11575 Nonsense Available for shipment Available now
sa18127 Nonsense Available for shipment Available now
sa26150 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa11575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035867 Nonsense 460 788 21 27
Genomic Location:
Chromosome 3 (position 53117544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTTATGTGWATRTTCCTCTTAGAAARAGAAWGTGAATCACATTTG[T/A]GTGTTTTGGGATCATGATTTGGATGGGGGTGCCTGGTCGAYCCGTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035867 Nonsense 592 788 23 27
Genomic Location:
Chromosome 3 (position 53123712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGGTTGCAGGTGTTCTGCATTACYTCTTCCTGGCYKCTTTCTGCTG[G/A]ATRTGTCTSGAAGGAGTGCAGCTYTTCCGCATGGTGGTGCTGGTTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26150
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035867 Essential Splice Site 667 788 24 27
Genomic Location:
Chromosome 3 (position 53124015)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATGGCTTCATCTGGAGCTTTTATGGGCCAGTTTGTATTATAATTGTT[G/A]TAAGTACCTCTTAGTTGCCATAAAAAGATTAGAAAATAGCATCTGGAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bvsby7qz