CD97 (1 of 3)

Ensembl ID:
ENSDARG00000026313
Description:
CD97 molecule [Source:HGNC Symbol;Acc:1711]
Human Orthologue:
CD97
Human Description:
CD97 molecule [Source:HGNC Symbol;Acc:1711]
Mouse Orthologue:
Cd97
Mouse Description:
CD97 antigen Gene [Source:MGI Symbol;Acc:MGI:1347095]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11575 Nonsense Available for shipment Available now
sa18127 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035867 Nonsense 460 788 21 27
Genomic Location:
Chromosome 3 (position 53117544)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTTATGTGWATRTTCCTCTTAGAAARAGAAWGTGAATCACATTTG[T/A]GTGTTTTGGGATCATGATTTGGATGGGGGTGCCTGGTCGAYCCGTAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18127
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035867 Nonsense 592 788 23 27
Genomic Location:
Chromosome 3 (position 53123712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTGGTTGCAGGTGTTCTGCATTACYTCTTCCTGGCYKCTTTCTGCTG[G/A]ATRTGTCTSGAAGGAGTGCAGCTYTTCCGCATGGTGGTGCTGGTTTTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bvsby7qz