erbb2

Ensembl ID:
ENSDARG00000026294
ZFIN ID:
ZDB-GENE-031118-121
Description:
receptor tyrosine-protein kinase erbB-2 [Source:RefSeq peptide;Acc:NP_956413]
Human Orthologue:
ERBB2
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homol
Mouse Orthologue:
Erbb2
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18607 Nonsense Available for shipment Available now
sa4453 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 197 1275 5 27
ENSDART00000114258 Nonsense 197 1275 5 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 10160581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTTTCAGGTCCTCGYTGCTCTTCAGCTTGYAAATCYGGTGGATGTT[G/A]GGGAGAAAAAGATCAGGACTGCCAAACAWGTGAGTGTGATTGATACAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003932 Nonsense 991 1275 25 27
ENSDART00000114258 Nonsense 991 1275 25 28

The following transcripts of ENSDARG00000026294 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 10122295)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATAGCATTTCTCTCCTTTCCACAGAACGAAGATCAGATGAGTCTKT[C/A]GAGTCCTGTTGATAGCGAGTTCTTCCGCATCYTGATGGCAGAGGAGGGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bi86skai