LOC565564

Ensembl ID:
ENSDARG00000026246
Human Orthologue:
ADORA3
Human Description:
adenosine A3 receptor [Source:HGNC Symbol;Acc:268]
Mouse Orthologues:
Adora3, Adora3
Mouse Descriptions:
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]
adenosine A3 receptor Gene [Source:MGI Symbol;Acc:MGI:104847]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20824 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064679 Nonsense 130 299 2 2
Genomic Location:
Chromosome 6 (position 54437751)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATCTCTTTCTATAGGTACAGGGGAGCAGTCAAAAAGCAGCACTTGT[G/A]GATTGCGGTCACTGTTTGTTGGCTCTCGGCTGCTATACTGGGTCTAATCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dm0bgjs0