NP_001070780.1

Ensembl ID:
ENSDARG00000026224
Description:
hypothetical protein LOC768169 [Source:RefSeq peptide;Acc:NP_001070780]
Human Orthologue:
FANCI
Human Description:
Fanconi anemia, complementation group I [Source:HGNC Symbol;Acc:25568]
Mouse Orthologue:
Fanci
Mouse Description:
Fanconi anemia, complementation group I Gene [Source:MGI Symbol;Acc:MGI:2384790]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9207 Nonsense Mutation detected in F1 DNA During 2017
sa38013 Nonsense Mutation detected in F1 DNA During 2017
sa38014 Nonsense Available for shipment Available now
sa39472 Nonsense Mutation detected in F1 DNA During 2017
sa7258 Nonsense Mutation detected in F1 DNA During 2017
sa8892 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 446 1273 13 34
ENSDART00000103145 Nonsense 443 949 13 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090 Nonsense 446 1327 14 38
Genomic Location (Zv9):
Chromosome 25 (position 8665667)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8380572
KASP Assay ID:
2261-9404.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTYTTTTATGCACAGATGCATGAACCAAWCAGAGGCGAGATACTTGAA[C/T]AAGTCTTGAACCGATTGGTTACTAAAACAGCCKCTCCTGTCACCCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 494 1273 14 34
ENSDART00000103145 Nonsense 491 949 14 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090 Nonsense 494 1327 15 38
Genomic Location (Zv9):
Chromosome 25 (position 8665898)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8380803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAATCTTCCTCTAAGGTCACAGAAACATTTGACCAGCTCTCTTATT[T/A]GCCTCTTAGTACAGTACAGGGGCTCCTCAAAGCGGTGCAGGTAACATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38014
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 918 1273 24 34
ENSDART00000103145 Nonsense 915 949 24 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090 Nonsense 918 1327 25 38
Genomic Location (Zv9):
Chromosome 25 (position 8676761)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8391666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGGAGAAGGGTCAGAGCGTCTCTTTACTATGTCTAGAGGGTTTACTG[C/T]GAGTCTTCACTACGGTACTACAGCGATACCCCACACGAGTCAGCAACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 1100 1273 30 34
ENSDART00000103145   None 949 None 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090 Nonsense 1100 1327 31 38
Genomic Location (Zv9):
Chromosome 25 (position 8680733)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8395638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTCAGGTCTTGTCTCAGGTTGGGAAGGTGTTGGATGAAGTGGACTG[G/A]TTGATCGCCAAGAAGAAAGCCCAGATAAGCTCAGACAGAACTATTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 1263 1273 34 34
ENSDART00000103145   None 949 None 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090   None 1327 None 38
ENSDART00000020998 Nonsense 1263 1273 34 34
ENSDART00000103145   None 949 None 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090   None 1327 None 38
Genomic Location (Zv9):
Chromosome 25 (position 8686346)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8401251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNACACACACTTTCACTTTWTTATCTGAGACTAAAACACACAGAA[C/T]GAGTTTTTTTTTTTTTTTTTTTATCCATAACTTAACATAAAATTATTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020998 Nonsense 1263 1273 34 34
ENSDART00000103145   None 949 None 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090   None 1327 None 38
ENSDART00000020998 Nonsense 1263 1273 34 34
ENSDART00000103145   None 949 None 26
ENSDART00000108747   None 204 None 7
ENSDART00000142090   None 1327 None 38
Genomic Location (Zv9):
Chromosome 25 (position 8686346)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 8401251
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNNACACACACTTTCACTTTWTTATCTGAGACTAAAACACACAGAA[C/T]GAGTTTTTTTTTTTTTTTTTTTATCCATAACTTAACRTAAAATTATTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link