prpf8

Ensembl ID:
ENSDARG00000026180
ZFIN ID:
ZDB-GENE-030131-577
Description:
pre-mRNA processing factor 8 [Source:RefSeq peptide;Acc:NP_957270]
Human Orthologue:
PRPF8
Human Description:
PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17340]
Mouse Orthologue:
Prpf8
Mouse Description:
pre-mRNA processing factor 8 Gene [Source:MGI Symbol;Acc:MGI:2179381]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2823 Nonsense F2 line generated During 2017
sa1289 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2823
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026434 Nonsense 1400 2342 24 41
ENSDART00000134601 Nonsense 1400 2342 25 42
Genomic Location (Zv9):
Chromosome 15 (position 27603302)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28321542
KASP Assay ID:
554-3379.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTGAGTTCATTGATTCTCAGAGAGTTTGGGCTGAATATGCCCTCAAG[C/T]GACAGGAGGCCATTGCTCAGAACAGGTACTGTCCTCTAAACCAAACCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1289
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026434 Nonsense 2042 2342 36 41
ENSDART00000134601 Nonsense 2042 2342 37 42
Genomic Location (Zv9):
Chromosome 15 (position 27600100)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28318340
KASP Assay ID:
554-1204.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCATCCCAGCAGAGACAGCAGATCGCTGAGATTGAGAAGCAGACCAAA[G/T]AGCAGTCTCAGCTTACGGCCACTCAGACTCGCACAGTCAACAAACACGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Calcium levels: Common variants in the calcium-sensing receptor gene are associated with total serum calcium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link