ube2cbp

Ensembl ID:
ENSDARG00000026178
ZFIN ID:
ZDB-GENE-091218-3
Description:
LOC553294 protein [Source:UniProtKB/TrEMBL;Acc:Q5EAZ8]
Human Orthologue:
UBE2CBP
Human Description:
ubiquitin-conjugating enzyme E2C binding protein [Source:HGNC Symbol;Acc:21381]
Mouse Orthologue:
Ube2cbp
Mouse Description:
ubiquitin-conjugating enzyme E2C binding protein Gene [Source:MGI Symbol;Acc:MGI:1917598]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7776 Nonsense Mutation detected in F1 DNA During 2014
sa2843 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038036 Nonsense 2 394 1 10
Genomic Location:
Chromosome 16 (position 5715136)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTCGCRTGGGATTTAWGAGTAGAATCGATGAATCCATAGCTTCTG[T/A]AAAGAAATACCAATGGAAGAGACTRCGAACACAGAWGTCCTCTTTMTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2843
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038036 Nonsense 134 394 4 10
Genomic Location:
Chromosome 16 (position 5721504)
KASP Assay ID:
554-2601.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTAAATGTTCATTTTTGGGTGAACTGTCTCTTTAAAGGTCTTTTGGA[C/T]GAGTTCTTCCTTTGCCCAATGGAAACTGGAATGCATTAGTGGACGACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3vcv2bup