hps1

Ensembl ID:
ENSDARG00000026170
ZFIN ID:
ZDB-GENE-051113-152
Description:
Hermansky-Pudlak syndrome 1 protein [Source:RefSeq peptide;Acc:NP_001032777]
Human Orthologue:
HPS1
Human Description:
Hermansky-Pudlak syndrome 1 [Source:HGNC Symbol;Acc:5163]
Mouse Orthologue:
Hps1
Mouse Description:
Hermansky-Pudlak syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2177763]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17216 Essential Splice Site Available for shipment Available now
sa1853 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa17216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Essential Splice Site 39 668 None 19
ENSDART00000109822 Essential Splice Site 39 668 None 17
ENSDART00000146112 Essential Splice Site 39 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 41306604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCGGCTTCAGGAGCAGTATGGARTCTCCCAGGAGGAAGGAGAAGGAG[T/A]ATGNNTTTTTTTTTGCTCTAGATTATCAAATAGTGCTGTTTGRCTTTCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1853
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057047 Essential Splice Site 222 668 8 19
ENSDART00000109822 Essential Splice Site 222 668 6 17
ENSDART00000146112 None None 56 None 4

The following transcripts of ENSDARG00000026170 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 41314833)
KASP Assay ID:
554-1844.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTAATTAATTGTAATCCAAATGTAATTCTTTTTTTTTCTGTGTGCA[G/A]TCGTAATGCCAGCAATCTGAACCCTTCTGATCTCCTGGCTCTGATCATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ygh9s1lh