emilin1b

Ensembl ID:
ENSDARG00000026166
ZFIN ID:
ZDB-GENE-060818-36
Description:
elastin microfibril interfacer 1b [Source:RefSeq peptide;Acc:NP_001038807]
Human Orthologue:
EMILIN1
Human Description:
elastin microfibril interfacer 1 [Source:HGNC Symbol;Acc:19880]
Mouse Orthologue:
Emilin1
Mouse Description:
elastin microfibril interfacer 1 Gene [Source:MGI Symbol;Acc:MGI:1926189]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105215 Nonsense 287 406 4 4
Genomic Location:
Chromosome 17 (position 12307101)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTCTTGTTCCGCCTRTCAGTCKGGAGTGGAAGACCTGAAACGACAA[C/T]AGCAACAAGATCGGGAGAGGATCTCGGYTTTGGAAAAGCAGATTAGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/55o1v1cv