col11a1a

Ensembl ID:
ENSDARG00000026165
ZFIN IDs:
ZDB-GENE-070209-167, ZDB-GENE-070209-167
Description:
collagen, type XI, alpha 1 [Source:RefSeq peptide;Acc:NP_001077313]
Human Orthologue:
COL11A1
Human Description:
collagen, type XI, alpha 1 [Source:HGNC Symbol;Acc:2186]
Mouse Orthologue:
Col11a1
Mouse Description:
collagen, type XI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88446]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13850 Nonsense Available for shipment Available now
sa8893 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32491 Essential Splice Site Available for shipment Available now
sa44162 Nonsense Mutation detected in F1 DNA During 2016
sa24520 Essential Splice Site Available for shipment Available now
sa39459 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503   None 231 2 67
ENSDART00000042065 Nonsense 78 1736 2 66
Genomic Location (Zv9):
Chromosome 24 (position 29808990)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28807306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKTCAGGATTCTGCACAAACCGAAGAGCATCACAGCCAGACGCGGCCTAC[A/T]AAATCAGCAAGAATGCCCAGCTCAGTGCCCCGACCAAGCAGCTTTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 262 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29779598)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28777914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGTCCCTCACAAGGACACACTGCAGGCACAGGAGCCCGGAGAGGAGG[T/G]CAGTAWATAGACCATGAGCCTTTTGGACTAGCTGACAGAGGAAATAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 8 67
ENSDART00000042065   None 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29771915)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28770231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCTCCATTGCTCAAACTCCCTTCCGCCGCATTGCTTTGGGTGTAATA[A/C]GGCCATGGAAGAGGAGAATTTTGGTGATTATATCACCGAGACGGCCCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503   None 231 10 67
ENSDART00000042065 Nonsense 375 1736 9 66
Genomic Location (Zv9):
Chromosome 24 (position 29770174)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28768490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATTGTGATTTTGGTGTGATTCAAAGGGAATGCTGATCGAGGGACCTT[C/A]AGGACCACCTGGACCTGCTGTAAGCAACTAGCATATTTACCTGCATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 528 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29759750)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28758066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGCTGATGGTGCCCGAGGAATGCCTGGAGAGTCTGGATCTAAGG[T/A]ATGGAAAATGTTTATTTGACCTTTTCATGCTCACATATAAGTTATGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 579 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29757764)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28756080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGGAGAAGATGGTGAGATCGGACCAAGAGGACTTGCTGGTGAGAGCG[T/C]AAGTGTGTCTTGCATTGACTAAATGCTTTATTTCTTGTTGGCCACCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 1258 1736 None 66
Genomic Location (Zv9):
Chromosome 24 (position 29717060)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 28715376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTCAAGTTNNNNNNNNNNNNNNNNNCTGTNNNNATCTAAAATCCTC[A/T]GGGAATAGATGGAGGCCCAGGAGAGAAGGGAGAGGATGGAGAGTCTGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link