col11a1a

Ensembl ID:
ENSDARG00000026165
ZFIN IDs:
ZDB-GENE-070209-167, ZDB-GENE-070209-167
Description:
collagen, type XI, alpha 1 [Source:RefSeq peptide;Acc:NP_001077313]
Human Orthologue:
COL11A1
Human Description:
collagen, type XI, alpha 1 [Source:HGNC Symbol;Acc:2186]
Mouse Orthologue:
Col11a1
Mouse Description:
collagen, type XI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88446]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13850 Nonsense Available for shipment Available now
sa8893 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24520 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11965 Essential Splice Site Available for shipment Available now
sa4271 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13850
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 None None 231 2 67
ENSDART00000042065 Nonsense 78 1736 2 66
Genomic Location:
Chromosome 24 (position 29808990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKTCAGGATTCTGCACAAACCGAAGAGCATCACAGCCAGACGCGGCCTAC[A/T]AAATCAGCAAGAATGCCCAGCTCAGTGCCCCGACCAAGCAGCTTTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 262 1736 None 66
Genomic Location:
Chromosome 24 (position 29779598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGTCCCTCACAAGGACACACTGCAGGCACAGGAGCCCGGAGAGGAGG[T/G]CAGTAWATAGACCATGAGCCTTTTGGACTAGCTGACAGAGGAAATAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 528 1736 None 66
Genomic Location:
Chromosome 24 (position 29759750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTGGAGCTGATGGTGCCCGAGGAATGCCTGGAGAGTCTGGATCTAAGG[T/A]ATGGAAAATGTTTATTTGACCTTTTCATGCTCACATATAAGTTATGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site None 231 None 67
ENSDART00000042065 Essential Splice Site 1258 1736 None 66
Genomic Location:
Chromosome 24 (position 29717060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTCAAGTTNNNNNNNNNNNNNNNNNCTGTNNNNATCTAAAATCCTC[A/T]GGGAATAGATGGAGGCCCAGGAGAGAAGGGAGAGGATGGAGAGTCTGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003503 Essential Splice Site 105 231 65 67
ENSDART00000042065 Essential Splice Site 1610 1736 64 66
Genomic Location:
Chromosome 24 (position 29693441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGAGGTGCCCGGCTCCTGGTTCAGTGAATTTAAGCGTGGCAAAATA[G/A]TAAGTGCACTTCCCCGTCTTTCTTTCATCTTCTCCTTTATGAAAAACATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2wtxp2ml