pdcd5

Ensembl ID:
ENSDARG00000026072
ZFIN ID:
ZDB-GENE-040426-980
Description:
programmed cell death protein 5 [Source:RefSeq peptide;Acc:NP_957471]
Human Orthologue:
PDCD5
Human Description:
programmed cell death 5 [Source:HGNC Symbol;Acc:8764]
Mouse Orthologue:
Pdcd5
Mouse Description:
programmed cell death 5 Gene [Source:MGI Symbol;Acc:MGI:1913538]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18058 Nonsense Available for shipment Available now
sa29054 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039495 Nonsense 6 128 1 6
Genomic Location (Zv9):
Chromosome 18 (position 30993849)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31126794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCTTTGAAAGTTCGGTGTGAATTTACAGAAATGGCTGATGAAGAAT[T/A]GGAAGCTATAAGACAGCAACGTATGGCCGAACTGCAAGCAAAACATGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039495 Nonsense 58 128 4 6
Genomic Location (Zv9):
Chromosome 18 (position 30981988)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31114933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAATCTGCAAATGTCTTTTGAAATCCTTTTTTCTTCTGCCCTTTTAG[T/A]GAGTAATTTGGCTCTTGTGAAGCCAGATAAAGCAAAAGCTGTGGAGAATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link