hltf

Ensembl ID:
ENSDARG00000026053
ZFIN ID:
ZDB-GENE-030131-3306
Description:
Helicase-like transcription factor [Source:UniProtKB/TrEMBL;Acc:B0V118]
Human Orthologue:
HLTF
Human Description:
helicase-like transcription factor [Source:HGNC Symbol;Acc:11099]
Mouse Orthologue:
Hltf
Mouse Description:
helicase-like transcription factor Gene [Source:MGI Symbol;Acc:MGI:1196437]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12894 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12894
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099350 Essential Splice Site 526 942 None 24
ENSDART00000132050 Essential Splice Site 526 942 None 25

The following transcripts of ENSDARG00000026053 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 24723902)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAGCTGTACTGGAGCTCCAGTCAGAGCGCAGGTGGATCCTGTCAGG[T/C]ACATTCACTTACAGTACCACTGGAGGTTGGCAGATTMCTCCCTCAGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ty3j8u9a