tsc1a

Ensembl ID:
ENSDARG00000026048
ZFIN ID:
ZDB-GENE-030131-9111
Description:
hamartin [Source:RefSeq peptide;Acc:NP_956346]
Human Orthologue:
TSC1
Human Description:
tuberous sclerosis 1 [Source:HGNC Symbol;Acc:12362]
Mouse Orthologue:
Tsc1
Mouse Description:
tuberous sclerosis 1 Gene [Source:MGI Symbol;Acc:MGI:1929183]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31448 Essential Splice Site Mutation detected in F1 DNA During 2016
sa12047 Essential Splice Site Available for shipment Available now
sa33623 Nonsense Mutation detected in F1 DNA During 2016
sa20445 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31448
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Essential Splice Site None 1128 2 22
Genomic Location:
Chromosome 5 (position 31292203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTTGTTTTTAGTCACATTAATGTTTTTATTTTTTATTTTGGGTCACCA[G/A]TTCATACATAGGCACCCCATGCTGACACCACAGGACATCGATTTCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Essential Splice Site 171 1128 5 22
Genomic Location:
Chromosome 5 (position 31295825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTTGATATCTTTGGACGTCTTGYTGCCTGGAACCAACGTCATCCAGG[T/C]ATAAACATTACAAATCATTTTTTATTTGGCTTCAGTTTTTGGATAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Nonsense 683 1128 16 22
Genomic Location:
Chromosome 5 (position 31301381)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCTGCTGCTGCATAACCAGTTGCTTTATGAGAGACATAAGAGAGAG[C/T]AACATGCGCTTCGTAACCGTCGTCTGTTTGGCCGCATCGTCAACACTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Nonsense 1109 1128 22 22
Genomic Location:
Chromosome 5 (position 31305700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCAGTTTGACCTGCAGCCAATGGATAGACCCCGGGCATATAATGTT[C/T]AGAGTAGGAGGCATCAGGATCTGCGGATCATGGACTATAATGAGACCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link