tsc1a

Ensembl ID:
ENSDARG00000026048
ZFIN ID:
ZDB-GENE-030131-9111
Description:
hamartin [Source:RefSeq peptide;Acc:NP_956346]
Human Orthologue:
TSC1
Human Description:
tuberous sclerosis 1 [Source:HGNC Symbol;Acc:12362]
Mouse Orthologue:
Tsc1
Mouse Description:
tuberous sclerosis 1 Gene [Source:MGI Symbol;Acc:MGI:1929183]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12047 Essential Splice Site Available for shipment Available now
sa20445 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Essential Splice Site 171 1128 5 22
Genomic Location:
Chromosome 5 (position 31295825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTTTGATATCTTTGGACGTCTTGYTGCCTGGAACCAACGTCATCCAGG[T/C]ATAAACATTACAAATCATTTTTTATTTGGCTTCAGTTTTTGGATAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035400 Nonsense 1109 1128 22 22
Genomic Location:
Chromosome 5 (position 31305700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACCAGTTTGACCTGCAGCCAATGGATAGACCCCGGGCATATAATGTT[C/T]AGAGTAGGAGGCATCAGGATCTGCGGATCATGGACTATAATGAGACCCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Psoriasis: Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8xsaqi4e