cyp1a

Ensembl ID:
ENSDARG00000026039
ZFIN ID:
ZDB-GENE-011219-1
Description:
cytochrome P450, family 1, subfamily A [Source:RefSeq peptide;Acc:NP_571954]
Human Orthologues:
CYP1A1, CYP1A2
Human Descriptions:
cytochrome P450, family 1, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2595]
cytochrome P450, family 1, subfamily A, polypeptide 2 [Source:HGNC Symbol;Acc:2596]
Mouse Orthologues:
Cyp1a1, Cyp1a2
Mouse Descriptions:
cytochrome P450, family 1, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88588]
cytochrome P450, family 1, subfamily a, polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:88589]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17179 Essential Splice Site Available for shipment Available now
sa4048 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038200 Essential Splice Site None 519 2 7
Genomic Location:
Chromosome 18 (position 4978092)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACTGATATTCCNNCTCTAATACCTCATTTATGTCTGCTTCCTTCTAAAC[A/T]GSTTATTAAATCAGCAAKGGCTCTRACTATTCTTCCAATATTGGGTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4048
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038200 Nonsense 295 519 3 7
Genomic Location:
Chromosome 18 (position 4980886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTYCAGGACAACATCAGAGACATCACCGACTCTCTTATCAACCACTGC[G/T]AAGACCGAAAACTGGACGAAAACTCCAACCTGCAAGTGTCCGATGAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8m3pxz9v