ankrd44

Ensembl ID:
ENSDARG00000026028
ZFIN ID:
ZDB-GENE-070912-605
Human Orthologue:
ANKRD44
Human Description:
ankyrin repeat domain 44 [Source:HGNC Symbol;Acc:25259]
Mouse Orthologues:
Ankrd44, E230028L10Rik
Mouse Descriptions:
ankyrin repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:3045243]
RIKEN cDNA E230028L10 gene Gene [Source:MGI Symbol;Acc:MGI:2685285]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25429 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15884 Essential Splice Site Available for shipment Available now
sa6117 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Essential Splice Site 9 1050 1 28
ENSDART00000142768 None None 1037 None 26
Genomic Location:
Chromosome 9 (position 33191569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGTCCAGTTTCACATGATATGGCTGTTCTCAAACTAGTCGACCAG[G/A]TAATTTACTAAGATTTTTTAAAATGTTTATAAAAATGAAGTTGACTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15884
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 None None 1050 None 28
ENSDART00000142768 Essential Splice Site 386 1037 11 26
Genomic Location:
Chromosome 9 (position 33166590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCTTCTGTGCACTGTATCCTTCCTCCTCATCCTTCCATTCCTCTACA[G/A]GACGGAGGTATAGCATAATGTGYCCTCTCAGTAATGACTCGGTCCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037182 Nonsense 590 1050 18 28
ENSDART00000142768 Nonsense 577 1037 16 26
Genomic Location:
Chromosome 9 (position 33153234)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACGCGCAGGCTCTAGAAGTGCTCTTGGAGGGTCACTGTGAGGTGGAT[C/T]AGGGGGATGAAGTTGRTCGGACTCCACTGGCCCTTGCTGCTCTCAGGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0gk7alrp