mospd2

Ensembl ID:
ENSDARG00000026024
ZFIN ID:
ZDB-GENE-041114-1
Description:
motile sperm domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001007294]
Human Orthologue:
MOSPD2
Human Description:
motile sperm domain containing 2 [Source:HGNC Symbol;Acc:28381]
Mouse Orthologue:
Mospd2
Mouse Description:
motile sperm domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1924013]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34794 Nonsense Mutation detected in F1 DNA During 2016
sa41559 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21618 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029528 Nonsense 6 526 1 15
Genomic Location:
Chromosome 9 (position 56990875)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAGACCACTGCTGACTGACAGCGCGCACTATCATGGCGGAGGCAGGA[C/T]AGGCGGAATCAGAGCAGGTAATTAGACAGCGAAACAAAAGCAGGATTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029528 Essential Splice Site 114 526 4 15
Genomic Location:
Chromosome 9 (position 56999542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGGTGCCGTTTACCTGCACGGATACGACAAAGAAGGAAACAAACTCTG[T/C]AAGACTTCATTTGGCATCTTAAATCTGCAGTTTAATTGGGGCTGTGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029528 Essential Splice Site 480 526 14 15
Genomic Location:
Chromosome 9 (position 57055766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGTCCTACAACAAACGTCAATGAGCATCAGGATCTGCAGAGCACGG[T/A]GAGAGATCTACACACAGAGTCTGGTTATTTAAAGCAACACATACAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link