xpnpep2

Ensembl ID:
ENSDARG00000026017
ZFIN ID:
ZDB-GENE-040426-1151
Description:
xaa-Pro aminopeptidase 2 [Source:RefSeq peptide;Acc:NP_957326]
Human Orthologue:
XPNPEP2
Human Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound [Source:HGNC Symbol;Acc:12823]
Mouse Orthologue:
Xpnpep2
Mouse Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound Gene [Source:MGI Symbol;Acc:MGI:2180001

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22514 Nonsense Mutation detected in F1 DNA During 2014
sa3883 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Nonsense 330 703 10 21
Genomic Location:
Chromosome 14 (position 34577761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGAATGCTTCGTGCTACCAGTCGCTCTGTGTTCATCTGCTCGAGTA[C/A]AGCTCTGTGCGCACGTATCTGCAGTCATATCTGCAGAGACCCAACGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Essential Splice Site 459 703 13 21
Genomic Location:
Chromosome 14 (position 34574364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAACCATTTCTGCAAGTGGACCCAATGCTGCTCTTGCTCACTACAGG[T/A]AATTTCATTGTTTATTATGTAAATTCMWTGTATTCGTATCTAGCATAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aopzgdya