xpnpep2

Ensembl ID:
ENSDARG00000026017
ZFIN ID:
ZDB-GENE-040426-1151
Description:
xaa-Pro aminopeptidase 2 [Source:RefSeq peptide;Acc:NP_957326]
Human Orthologue:
XPNPEP2
Human Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound [Source:HGNC Symbol;Acc:12823]
Mouse Orthologue:
Xpnpep2
Mouse Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound Gene [Source:MGI Symbol;Acc:MGI:2180001

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35721 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22514 Nonsense Mutation detected in F1 DNA During 2016
sa3883 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Essential Splice Site 45 703 1 21
Genomic Location:
Chromosome 14 (position 34588618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTCCTCAGGCTGGATACTGGCTGTGTGTCTTGTGGTTCTTGGAGG[T/C]AAATAAATAAATAAGTGTGTATGCGATGCCGATTTCATCTCGATGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Nonsense 330 703 10 21
Genomic Location:
Chromosome 14 (position 34577761)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGAATGCTTCGTGCTACCAGTCGCTCTGTGTTCATCTGCTCGAGTA[C/A]AGCTCTGTGCGCACGTATCTGCAGTCATATCTGCAGAGACCCAACGTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Essential Splice Site 459 703 13 21
Genomic Location:
Chromosome 14 (position 34574364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAACCATTTCTGCAAGTGGACCCAATGCTGCTCTTGCTCACTACAGG[T/A]AATTTCATTGTTTATTATGTAAATTCMWTGTATTCGTATCTAGCATAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link