xpnpep2

Ensembl ID:
ENSDARG00000026017
ZFIN ID:
ZDB-GENE-040426-1151
Description:
xaa-Pro aminopeptidase 2 [Source:RefSeq peptide;Acc:NP_957326]
Human Orthologue:
XPNPEP2
Human Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound [Source:HGNC Symbol;Acc:12823]
Mouse Orthologue:
Xpnpep2
Mouse Description:
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound Gene [Source:MGI Symbol;Acc:MGI:2180001

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35721 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Essential Splice Site 45 703 1 21
Genomic Location (Zv9):
Chromosome 14 (position 34588618)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33273318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTCCTCAGGCTGGATACTGGCTGTGTGTCTTGTGGTTCTTGGAGG[T/C]AAATAAATAAATAAGTGTGTATGCGATGCCGATTTCATCTCGATGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010022 Nonsense 330 703 10 21
Genomic Location (Zv9):
Chromosome 14 (position 34577761)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33262461
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGAATGCTTCGTGCTACCAGTCGCTCTGTGTTCATCTGCTCGAGTA[C/A]AGCTCTGTGCGCACGTATCTGCAGTCATATCTGCAGAGACCCAACGTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link