si:ch211-45m15.2

Ensembl ID:
ENSDARG00000025983
ZFIN ID:
ZDB-GENE-040724-127
Description:
Novel protein similar to human and mouse l(3)mbt-like 3 (Drosophila) (L3MBTL3) [Source:UniProtKB/TrE
Human Orthologue:
L3MBTL3
Human Description:
l(3)mbt-like 3 (Drosophila) [Source:HGNC Symbol;Acc:23035]
Mouse Orthologue:
L3mbtl3
Mouse Description:
l(3)mbt-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2143628]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9692 Nonsense Available for shipment Available now
sa30715 Nonsense Mutation detected in F1 DNA During 2017
sa39266 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039249 Nonsense 62 490 2 14
ENSDART00000047308 Nonsense 61 739 2 20
Genomic Location (Zv9):
Chromosome 20 (position 2163970)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2118255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGCAGGATTCTCCTTGGGGTCAGCGCGGCCTGGTGYGTGTGCGCTG[T/A]AACAGGAAGGGCTCTGCGGTGGACTTCCTGCCTGATGGCCTTCACTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039249 Nonsense 263 490 7 14
ENSDART00000047308 Nonsense 256 739 7 20
Genomic Location (Zv9):
Chromosome 20 (position 2176888)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2131173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACTCCAACTCTCCCGACATTCACCCTGTGGGCTGGTGTGAGAAAACC[G/T]GACACAAGTTACACCCACCGAAAGGTGTGCGGGTGAATATGTGATGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039249 Nonsense 453 490 13 14
ENSDART00000047308 Nonsense 446 739 13 20
Genomic Location (Zv9):
Chromosome 20 (position 2193755)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2148040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTAATTCTCTCTTTCAGATCCATTTTGATGGCTGGACAGATGAATA[T/A]GATTACTGGATCGATGCAGACAGTCCAGACGTTCATCCAGCTGGCTGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link