si:ch211-1l10.1

Ensembl ID:
ENSDARG00000025974
ZFIN ID:
ZDB-GENE-060503-301
Description:
Novel protein similar to human membrane-associated guanylate kinase-related (MAGI-3) (MAGI-3) [Sourc
Human Orthologue:
MAGI3
Human Description:
membrane associated guanylate kinase, WW and PDZ domain containing 3 [Source:HGNC Symbol;Acc:29647]
Mouse Orthologue:
Magi3
Mouse Description:
membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40786 Essential Splice Site Mutation detected in F1 DNA During 2017
sa20809 Nonsense Available for shipment Available now
sa31538 Nonsense Available for shipment Available now
sa40785 Nonsense Mutation detected in F1 DNA During 2017
sa20808 Essential Splice Site Available for shipment Available now
sa15982 Essential Splice Site Available for shipment Available now
sa44644 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31537 Nonsense Available for shipment Available now
sa20807 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Essential Splice Site 243 1014 7 21
ENSDART00000136726 Essential Splice Site 337 663 6 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47514771)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47575423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCGTCTGGTGAAAAAAGCCAAGCCTCCTGAAAAGTGTGAGGATGGAGG[T/C]GAATCTCTGCATGCACACGCTATACCTGAATATGCAAAACAACTATACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Nonsense 249 1014 8 21
ENSDART00000136726 Nonsense 340 663 7 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47511911)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47572563
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCATTTAATCTCAATCCTCTCATTCCCGGATCATCAGAGCTTCCATA[C/A]GGATGGGAGGAGATTGATGACCCGCAGTACGGCACATATTATGTAGAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Nonsense 325 1014 10 21
ENSDART00000136726 Nonsense 423 663 9 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47502288)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47562940
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGACTCAGCTGAAGGGGGAGCTCTATCACACGGCTCTCAGGAAGAGCCAG[C/T]AGGGCTTCGGCTTCACCATCATTGGAGGAGACCGATCGGATGAGTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Nonsense 483 1014 11 21
ENSDART00000136726 Nonsense 581 663 10 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47499175)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47559827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCCTGCGAGCAGCGCTGCCAACGACAGACCAGAAACAGGGATGCTG[C/T]AGCCGGAGCTGGTGAGCGTGCCAATCGTGAAGGGACCTGGAGGATTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20808
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Essential Splice Site 632 1014 12 21
ENSDART00000136726   None 663 None 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47488870)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47549522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCTTCCCTTCACTATAGTAAACCCAAAGCCCTGACGGAGAGCATAG[G/A]TGAGTCTGTGCTGAGCTCAGCCCTCAGAGAGAAAAGTCTTTTATGGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15982
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Essential Splice Site 633 1014 12 21
ENSDART00000136726   None 663 None 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47488869)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47549521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTTCCCTTCACTATAGTAAACCCAAAGCCCTGRCGGAGAGCATAGG[T/C]GAGTCTGTGCTGAGCTCAGCCCTCAGAGAGRAAAGTCTTTTATGGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44644
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Essential Splice Site 633 1014 13 21
ENSDART00000136726   None 663 None 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377   1 247 1 5
Genomic Location (Zv9):
Chromosome 6 (position 47487418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGTGGTTAATCCTATTCAGGTATTTAATTCTGCTTTTTATTATCCA[G/A]TACCTCAATATAAAGAGCTGGATGTGTTCATCAAAAGAGATCAGGAGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Nonsense 716 1014 14 21
ENSDART00000136726   None 663 None 10
ENSDART00000137374   None 87 None 2
ENSDART00000140377 Nonsense 84 247 2 5
Genomic Location (Zv9):
Chromosome 6 (position 47480876)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47541528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTCACAAACAAGTCCTGGACCTGATGACAAACGCAGCACGCAACGGA[C/T]AAGTGCTGCTTTCAGTGCGCAGGAAGGTCATTTTCCGAGGTGAGAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044487 Nonsense 965 1014 20 21
ENSDART00000136726   None 663 None 10
ENSDART00000137374 Nonsense 54 87 2 2
ENSDART00000140377   None 247 None 5
Genomic Location (Zv9):
Chromosome 6 (position 47473775)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 47534427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTGCCCTTTGCAGGTAGGAGATCAGGTTGTGGAGATCAATGGCGAA[C/T]AGACACAAGGCATCAGTCACACTAGAGCCATTGAGCTGATCCAAGCTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link