rhoq

Ensembl ID:
ENSDARG00000025953
ZFIN ID:
ZDB-GENE-030131-5721
Description:
rho-related GTP-binding protein RhoQ [Source:RefSeq peptide;Acc:NP_956112]
Human Orthologue:
RHOQ
Human Description:
ras homolog gene family, member Q [Source:HGNC Symbol;Acc:17736]
Mouse Orthologue:
Rhoq
Mouse Description:
ras homolog gene family, member Q Gene [Source:MGI Symbol;Acc:MGI:1931553]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038415 Nonsense 70 205 3 5
ENSDART00000135368 None None 67 None 2
Genomic Location:
Chromosome 12 (position 26651116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTYTGTACTTGTTTTAAYCCAGTGTCCTCTGCTCTGACAGGAGGACTA[T/A]GATCGCCTGCGACCCCTGTCCTATCCWATGACGGATGTCTTCCTCATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rcgeqorl