A8WIP4_DANRE

Ensembl ID:
ENSDARG00000025949
Description:
Novel protein similar to vertebrate interleukin-1 receptor-associated kinase 1 (IRAK1) [Source:UniPr
Human Orthologue:
IRAK1
Human Description:
interleukin-1 receptor-associated kinase 1 [Source:HGNC Symbol;Acc:6112]
Mouse Orthologue:
Irak1
Mouse Description:
interleukin-1 receptor-associated kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107420]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15573 Essential Splice Site Available for shipment Available now
sa41119 Nonsense Mutation detected in F1 DNA During 2016
sa21195 Nonsense Mutation detected in F1 DNA During 2016
sa5467 Nonsense Mutation detected in F1 DNA During 2016
sa34296 Essential Splice Site, Missense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101527 Essential Splice Site 29 685 None 18
ENSDART00000137975   None 553 None 11

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 8140035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACTCGGGTTATGGACTCRCTTTCAAACTCAGACKGGATATCWTTCGG[T/C]AAGATTCATGGCKTTGTGTTTGTTTTTGTATCACAATKGTGCTGTGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41119
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101527 Nonsense 71 685 2 18
ENSDART00000137975   None 553 None 11

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 8132605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATTGGGGTTGTCGCAATGGGACAGTTGGAGCACTGCTGAAGATTCTT[G/T]AGGGACTCCAGTGGTTCAGAGCTCGTGATATCATTCTCAAAGCACAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101527 Nonsense 261 685 11 18
ENSDART00000137975 Nonsense 140 553 5 11
Genomic Location:
Chromosome 8 (position 8126516)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAGGTACAGACATCCCAACATTATGGACTTTGTTGGCTACTGTATTT[C/A]AGGACAAACTTACTGTGTCATATATGTTTATATGCCCAACGGCTCTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101527 Nonsense 441 685 15 18
ENSDART00000137975 Nonsense 318 553 9 11
Genomic Location:
Chromosome 8 (position 8113858)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGATGGGAGAAGCTTCAGCAAAGCGAAGCACTCTCGAGATTTGTCCTA[C/A]GGTCAAACAGCAGAGCACATCTGCAAAAAACATCTGGATCSTCGACTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101527 Essential Splice Site 632 685 None 18
ENSDART00000137975 Missense 518 553 11 11
Genomic Location:
Chromosome 8 (position 8111231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTCTAATTCTCATCTTAATATTATTATCCACAGGTTTTTCTGGAC[A/T]GAATGTTATCATCAACCCCGCTAGGCAGCGATTGGTACAGAAAATGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link