mlh1

Ensembl ID:
ENSDARG00000025948
ZFIN ID:
ZDB-GENE-040426-1600
Description:
DNA mismatch repair protein Mlh1 [Source:RefSeq peptide;Acc:NP_956953]
Human Orthologue:
MLH1
Human Description:
mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) [Source:HGNC Symbol;Acc:7127]
Mouse Orthologue:
Mlh1
Mouse Description:
mutL homolog 1 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101938]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14372 Essential Splice Site Available for shipment Available now
hu1919 Splice Site, Nonsense Available for shipment Available now
sa31959 Nonsense Mutation detected in F1 DNA During 2016
sa31960 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14372
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038360 Essential Splice Site 179 724 7 20
ENSDART00000133388 Essential Splice Site 180 725 7 20
ENSDART00000147996 Essential Splice Site 180 215 6 8
Genomic Location:
Chromosome 13 (position 43258687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGAGCCCCAGTGAGGAATATTCCAGAATCGTCGAGGTTGTGAGCAG[G/A]TGTGTTTCACSACATTCAGAAGGCTCTTCTTTTATCTTTAGRTCCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu1919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038360 Splice Site, Nonsense 262 724 11 20
ENSDART00000133388 Splice Site, Nonsense 263 725 11 20
ENSDART00000147996   None 215 None 8
Genomic Location:
Chromosome 13 (position 43260213)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTATGGATAAGCACATCTTTTTAATCACCTTGTTGTCTTCTAGAT[C/T]GATTGGTGGAGTCTAGTGCCTTGAAGAAAGCAATTGAGACCGTCTACACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038360 Nonsense 271 724 11 20
ENSDART00000133388 Nonsense 272 725 11 20
ENSDART00000147996   None 215 None 8
Genomic Location:
Chromosome 13 (position 43260240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCACCTTGTTGTCTTCTAGATCGATTGGTGGAGTCTAGTGCCTTGAAG[A/T]AAGCAATTGAGACCGTCTACACCGCTTATCTTCCCAAAAACACTCATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038360 Nonsense 280 724 11 20
ENSDART00000133388 Nonsense 281 725 11 20
ENSDART00000147996   None 215 None 8
Genomic Location:
Chromosome 13 (position 43260269)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGTCTAGTGCCTTGAAGAAAGCAATTGAGACCGTCTACACCGCTTA[T/A]CTTCCCAAAAACACTCATCCTTTTCTTTATCTCAGGTAAATCAATAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link