TIAM1 (1 of 2)

Ensembl ID:
ENSDARG00000025920
Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Human Orthologue:
TIAM1
Human Description:
T-cell lymphoma invasion and metastasis 1 [Source:HGNC Symbol;Acc:11805]
Mouse Orthologue:
Tiam1
Mouse Description:
T-cell lymphoma invasion and metastasis 1 Gene [Source:MGI Symbol;Acc:MGI:103306]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35986 Nonsense Mutation detected in F1 DNA During 2016
sa28533 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32061 Nonsense Mutation detected in F1 DNA During 2016
sa10824 Essential Splice Site Available for shipment Available now
sa24996 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 13 1562 1 27
Genomic Location:
Chromosome 15 (position 40961487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATTTTGAGTCATGGGTAATGCAGAGAGTCACAGCGGTGGCCATGGCTA[T/A]TATGGAGACGGTCAGCGGCAACTGTCTCGAAAACACATGTCCCGCTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Essential Splice Site 261 1562 2 27
Genomic Location:
Chromosome 15 (position 40964417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCAATCAGCAGGGGGTTATGCAAGGGAGGCGGGCACAAACCATACAGG[T/C]GAGGTTCTTATTGGGTGACCATTCCTAGAGTGAAGTCTTATTGGTCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 1127 1562 20 27
Genomic Location:
Chromosome 15 (position 41066543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTTCCTCCAGCGAAGACAGACGCAGCCTTCAAGGCCTTTCTGGAT[G/T]AACGTAACCCCAAACAGCAGCATTCGTCCACGCTGGAGTCATACCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10824
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Essential Splice Site 1175 1562 21 27
Genomic Location:
Chromosome 15 (position 41068898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTCATGATACCTGACTGCTATTTGATCTCTCCTCTCTGCTGTGTGCA[G/A]TTGCAATGAAAGCCATGAACACAGTGGCCAGCCACATCAATGAGATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089694 Nonsense 1547 1562 27 27
Genomic Location:
Chromosome 15 (position 41079508)
KASP Assay ID:
554-7794.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGCCAGCGTTGACGAGCAAGCGACATCTGATGATGTTGTCTGGGTG[C/T]GACGGGACAGCGGTGCAGAGAACGAGACACAGGACGAAAGCCAGAGCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link