tecrb

Ensembl ID:
ENSDARG00000025904
ZFIN ID:
ZDB-GENE-030131-5154
Description:
trans-2,3-enoyl-CoA reductase [Source:RefSeq peptide;Acc:NP_958456]
Human Orthologue:
TECR
Human Description:
trans-2,3-enoyl-CoA reductase [Source:HGNC Symbol;Acc:4551]
Mouse Orthologue:
Tecr
Mouse Description:
trans-2,3-enoyl-CoA reductase Gene [Source:MGI Symbol;Acc:MGI:1915408]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19619 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14957 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108838 Essential Splice Site 128 308 6 12
ENSDART00000134770 Essential Splice Site 44 181 2 8
ENSDART00000139312 Essential Splice Site 117 205 5 9
ENSDART00000144983 Essential Splice Site 168 242 5 8
Genomic Location:
Chromosome 1 (position 56308430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATGCACCCAAATACGACTTCACCACCAGCAAACACTGGGTCGTACA[G/A]TAAGTCATTGAAGCAGTCATGAAATGCTTCAGTTTTATTTTATTTTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108838 Nonsense 294 308 12 12
ENSDART00000134770 None None 181 None 8
ENSDART00000139312 None None 205 None 9
ENSDART00000144983 None None 242 None 8
Genomic Location:
Chromosome 1 (position 56316497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGACMGTGTGGGCCAAAGGAAAGCACCGCAGYTACCTGAAGGAGTTT[C/T]GAGATTACCCCACRCTCCGCTCGCCCATCCTGCCCTTCATCCTGTAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ys5jfo6i