lgals9l1

Ensembl ID:
ENSDARG00000025903
ZFIN ID:
ZDB-GENE-030131-9543
Description:
lectin, galactoside-binding, soluble, 9 (galectin 9)-like 1 [Source:RefSeq peptide;Acc:NP_956366]
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11406 Essential Splice Site Available for shipment Available now
sa42572 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42571 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048729 Essential Splice Site 151 320 5 12
ENSDART00000100145   None 310 None 10
Genomic Location:
Chromosome 15 (position 30338439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACATGTGGTCATWACAAATCTTTTCTCACAAATGACTTCCTTTTTCTG[A/C]GCCATTTTGGCAATCATTTGCTWGTATGTTTTGAAATRATGTGTGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048729 Essential Splice Site 220 320 10 12
ENSDART00000100145 Essential Splice Site 210 310 8 10
Genomic Location:
Chromosome 15 (position 30333165)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAAAAACATTGTCATCAATGGAGTTGTCAACCCTAATGCTAAAAGG[T/C]TAGACATTTAATTGGAACAGTGTTGTTTGAATTTCAACTAACATTTCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048729 Essential Splice Site 272 320 11 12
ENSDART00000100145 Essential Splice Site 262 310 9 10
Genomic Location:
Chromosome 15 (position 30332894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGAACGGTTTGGAGGGCTGCCATTTCACAAAGGACAACCTTTTCAGG[T/C]AGAACTTACCCTGAACATATGAAATTGTTGCTTTTAAAGAGATTGTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link