lgals9l1

Ensembl ID:
ENSDARG00000025903
ZFIN ID:
ZDB-GENE-030131-9543
Description:
lectin, galactoside-binding, soluble, 9 (galectin 9)-like 1 [Source:RefSeq peptide;Acc:NP_956366]
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11406 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048729 Essential Splice Site 151 320 5 12
ENSDART00000100145 None None 310 None 10
Genomic Location:
Chromosome 15 (position 30338439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACATGTGGTCATWACAAATCTTTTCTCACAAATGACTTCCTTTTTCTG[A/C]GCCATTTTGGCAATCATTTGCTWGTATGTTTTGAAATRATGTGTGAAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jveblwkx