plekhg5

Ensembl ID:
ENSDARG00000025902
ZFIN ID:
ZDB-GENE-060503-766
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LYR1]
Human Orthologue:
PLEKHG5
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 5 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg5
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 5 Gene [Source:MGI Symbo

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41835 Nonsense Mutation detected in F1 DNA During 2017
sa35079 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41834 Nonsense Mutation detected in F1 DNA During 2017
sa31827 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41835
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067078 Nonsense 40 1135 2 20
ENSDART00000145733   None 783 None 11
Genomic Location (Zv9):
Chromosome 11 (position 25459252)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24288077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGAACAGAAACCCGGCCTCTTGTGTCAGCATCCCAACTGTCCCGAA[C/T]AGCGGCTTGCATCCAAGGTAAGCCATCAGAATGTGTTACAAGGGAAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067078 Essential Splice Site 177 1135 6 20
ENSDART00000145733   None 783 None 11
Genomic Location (Zv9):
Chromosome 11 (position 25437131)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24265956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAGGTCAGCATGGAGATCGTCCCAGCCGTGAAGAAGAAAACCTTGAG[G/A]TGATTTTGTGCTTGAGCCCCTAGGGGGTGCAATAAACTAATCGATGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067078 Nonsense 388 1135 10 20
ENSDART00000145733 Nonsense 36 783 1 11
Genomic Location (Zv9):
Chromosome 11 (position 25417356)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24246181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTACCCAAGATGCCTCCGCAGCTCTCGTTCCACAGAGACTCTTGGGAA[G/T]AGGAGCCCAATCTGGAGCTTGAAGAGAGCTGGAAGCAGCTTTTGGAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31827
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067078 Nonsense 860 1135 19 20
ENSDART00000145733 Nonsense 508 783 10 11
Genomic Location (Zv9):
Chromosome 11 (position 25405599)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24234424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCGCTGCTGTCTGATGACTCCTTTTCCACCAGCGACAGCAAAACTCTA[C/T]AAGCTCTGGGGGATTTAATCGTTACAGATTTAGATCCAGAAAGTCGCTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • QT interval: Common variants at ten loci influence QT interval duration in the QTGEN Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link