pnx

Ensembl ID:
ENSDARG00000025899
ZFIN ID:
ZDB-GENE-030328-42
Description:
posterior neuron-specific homeobox [Source:RefSeq peptide;Acc:NP_840087]
Human Orthologue:
NKX1-1
Human Description:
NK1 homeobox 1 [Source:HGNC Symbol;Acc:24975]
Mouse Orthologues:
Nkx1-1, Nkx1-2
Mouse Descriptions:
NK1 transcription factor related, locus 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:109346]
NK1 transcription factor related, locus 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104806]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21634 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030709 Nonsense 118 182 2 2
Genomic Location (Zv9):
Chromosome 10 (position 2828631)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2774268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAGCCCTCGGCCTCTCAGAAACGCAGGTCAAGATCTGGTTTCAGAAC[C/T]GACGCACCAAATGGAAGAAGGAGCTGGACGGTCACGGTGGAGAAGAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link