shox

Ensembl ID:
ENSDARG00000025891
ZFIN ID:
ZDB-GENE-051030-21
Description:
short stature homeobox protein isoform 1 [Source:RefSeq peptide;Acc:NP_001119883]
Human Orthologue:
SHOX
Human Description:
short stature homeobox [Source:HGNC Symbol;Acc:10853]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41471 Nonsense Mutation detected in F1 DNA During 2017
sa1370 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029238 Nonsense 38 304 1 6
ENSDART00000100735 Nonsense 38 261 1 6
ENSDART00000133996 Nonsense 38 285 1 5
Genomic Location (Zv9):
Chromosome 9 (position 35612766)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34832277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAGCATCACGTACAGGGAAGTTTTGGAGAGTGGTTTAGCCCGAGCC[A/T]GAGAGCTGGGAAACTCGGAGACCAACCTTCAGGAGATTACTGAAACAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029238 Nonsense 209 304 5 6
ENSDART00000100735 Nonsense 209 261 5 6
ENSDART00000133996 Nonsense 209 285 5 5
Genomic Location (Zv9):
Chromosome 9 (position 35618666)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34838177
KASP Assay ID:
554-1282.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTAACTCGCTGTTTGTTTTTGCTCGCCCCGCAGGTYCARGCTCAGTTG[C/T]AGTTGGAGGGGGTCGGAACACACTCCCATCCTCACCTGCACCCACACCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link