usp14

Ensembl ID:
ENSDARG00000025889
ZFIN ID:
ZDB-GENE-030131-7676
Description:
ubiquitin carboxyl-terminal hydrolase 14 [Source:RefSeq peptide;Acc:NP_956267]
Human Orthologue:
USP14
Human Description:
ubiquitin specific peptidase 14 (tRNA-guanine transglycosylase) [Source:HGNC Symbol;Acc:12612]
Mouse Orthologue:
Usp14
Mouse Description:
ubiquitin specific peptidase 14 Gene [Source:MGI Symbol;Acc:MGI:1928898]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19655 Nonsense Available for shipment Available now
sa19654 Nonsense Available for shipment Available now
sa15236 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 30 489 2 16
Genomic Location (Zv9):
Chromosome 2 (position 2960305)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2967330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGTTTGATGCGGTGGAGCTGAACACAGAGGAGCCGCCCATGGTGTTC[A/T]AAGCCCAGCTGTTCGCTCTAACAGGAGTTCAGCCAGAGAGACAGAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 401 489 14 16
Genomic Location (Zv9):
Chromosome 2 (position 2943928)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2950953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTCAACAGCCGAATAAGAAGCCTGGTGCTCTAAAGGAGACAAAATA[T/G]GAACCTTTTAGTTTTCCCGATGGTAAGTGCTTAATGCAGAGGATCAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032540 Nonsense 441 489 15 16
Genomic Location (Zv9):
Chromosome 2 (position 2943726)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2950751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGCATCAGGGCCGATCCAGCTCATCTGGCCATTATGTCKCCTGGGTT[A/T]AAAGGAAAGAAGGTCAAGTATCAACAATATCTATTGAACACTCAAKTYGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link