dmtf1

Ensembl ID:
ENSDARG00000025824
ZFIN ID:
ZDB-GENE-040718-413
Description:
Cyclin-D-binding Myb-like transcription factor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DG03]
Human Orthologue:
DMTF1
Human Description:
cyclin D binding myb-like transcription factor 1 [Source:HGNC Symbol;Acc:14603]
Mouse Orthologues:
4932411N23Rik, Dmtf1
Mouse Descriptions:
cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]
RIKEN cDNA 4932411N23 gene Gene [Source:MGI Symbol;Acc:MGI:3045322]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33393 Essential Splice Site Mutation detected in F1 DNA During 2017
sa40225 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029084 Essential Splice Site 220 645 7 17
ENSDART00000133214 Essential Splice Site 220 590 7 16
Genomic Location (Zv9):
Chromosome 4 (position 8723617)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9660465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACAGACGTGTGTTGCGAATGTACGATAACCGCAACCACGTAGGCAAG[T/C]AAGGACGTAGCTGCTTTTGTTTGTTAGTTCAACAGATTTACACCCCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029084 Essential Splice Site 445 645 12 17
ENSDART00000133214   None 590 None 16
Genomic Location (Zv9):
Chromosome 4 (position 8720909)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 9657757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGCTCTGCAGATCCCGGTCCAGATCCCAGTGCAGATCACACACGTCT[G/T]TGAGTGTATATATATATATAAAAGGAGCTTTTGTGACTGTTGTTTCAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link