
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dmtf1
- Ensembl ID:
- ENSDARG00000025824
- ZFIN ID:
- ZDB-GENE-040718-413
- Description:
- Cyclin-D-binding Myb-like transcription factor 1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DG03]
- Human Orthologue:
- DMTF1
- Human Description:
- cyclin D binding myb-like transcription factor 1 [Source:HGNC Symbol;Acc:14603]
- Mouse Orthologues:
- 4932411N23Rik, Dmtf1
- Mouse Descriptions:
- cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]
- RIKEN cDNA 4932411N23 gene Gene [Source:MGI Symbol;Acc:MGI:3045322]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa33393 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa40225 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33393
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029084 | Essential Splice Site | 220 | 645 | 7 | 17 |
ENSDART00000133214 | Essential Splice Site | 220 | 590 | 7 | 16 |
- Genomic Location (Zv9):
- Chromosome 4 (position 8723617)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 9660465 GRCz11 4 9661381 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATACAGACGTGTGTTGCGAATGTACGATAACCGCAACCACGTAGGCAAG[T/C]AAGGACGTAGCTGCTTTTGTTTGTTAGTTCAACAGATTTACACCCCATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40225
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000029084 | Essential Splice Site | 445 | 645 | 12 | 17 |
ENSDART00000133214 | None | 590 | None | 16 |
- Genomic Location (Zv9):
- Chromosome 4 (position 8720909)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 9657757 GRCz11 4 9658673 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCGCTCTGCAGATCCCGGTCCAGATCCCAGTGCAGATCACACACGTCT[G/T]TGAGTGTATATATATATATAAAAGGAGCTTTTGTGACTGTTGTTTCAGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder and major depressive disorder (combined): Meta-analysis of genome-wide association data of bipolar disorder and major depressive disorder. (View Study)
- Brachial circumference: Genome-wide association study to identify common variants associated with brachial circumference: a meta-analysis of 14 cohorts. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: