chek2

Ensembl ID:
ENSDARG00000025820
ZFIN ID:
ZDB-GENE-030131-8942
Description:
serine/threonine-protein kinase Chk2 [Source:RefSeq peptide;Acc:NP_956339]
Human Orthologue:
CHEK2
Human Description:
CHK2 checkpoint homolog (S. pombe) [Source:HGNC Symbol;Acc:16627]
Mouse Orthologue:
Chek2
Mouse Description:
CHK2 checkpoint homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1355321]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20350 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036421 Nonsense 261 503 8 15
Genomic Location:
Chromosome 5 (position 10977188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTCTCTCTCCTCCTTTAGCCGTGCCTGATCAAAACTGAAGATTTCTA[C/A]CAGACTGAAGACTCCTACTACATTGTTTTGGAGTAGTAAGTAGTGTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/abxigcgh