taf5l

Ensembl ID:
ENSDARG00000025808
ZFIN IDs:
ZDB-GENE-030131-5987, ZDB-GENE-030131-5987
Description:
TAF5-like RNA polymerase II p300/CBP-associated factor-associated factor 65 kDa subunit 5L [Source:
Human Orthologue:
TAF5L
Human Description:
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa [Source:HGNC
Mouse Orthologue:
Taf5l
Mouse Description:
TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor Gene [Source:MGI Sy

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4869 Nonsense Mutation detected in F1 DNA During 2014
sa19609 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032552 Nonsense 69 601 3 7
ENSDART00000125063 Nonsense 69 601 2 6
Genomic Location:
Chromosome 1 (position 54483696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCCAATGTGGTGTCCGCGGCCCCGTGTCAGGCGGACCCTCAGCAGTA[C/A]GAAAACCAGTWCTCCAGGCTACGCTCCTTCCTGCAGGGTGAGACCAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032552 Essential Splice Site 82 601 4 7
ENSDART00000125063 Essential Splice Site 82 601 3 6
Genomic Location:
Chromosome 1 (position 54482320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGTCTATCTGAGCTGCTGTGGTTTCATCAGCTCTTCTTTCTGTTGTC[A/T]GAGGCTGAAGGGCCTCTGGTAAAGGAGGCGAGCAGCGTCTTGTTCCCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fawssmpx