mapk10

Ensembl ID:
ENSDARG00000025747
ZFIN ID:
ZDB-GENE-051120-117
Description:
mitogen-activated protein kinase 10 [Source:RefSeq peptide;Acc:NP_001032790]
Human Orthologue:
MAPK10
Human Description:
mitogen-activated protein kinase 10 [Source:HGNC Symbol;Acc:6872]
Mouse Orthologue:
Mapk10
Mouse Description:
mitogen-activated protein kinase 10 Gene [Source:MGI Symbol;Acc:MGI:1346863]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23859 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042429 None None 384 None 11
ENSDART00000086509 Nonsense 26 430 5 16
ENSDART00000086521 Nonsense 26 430 2 13
ENSDART00000134195 None None 384 4 14
ENSDART00000134892 Nonsense 29 433 3 14
ENSDART00000141848 Nonsense 26 430 4 15
ENSDART00000142547 None None 210 None 6
ENSDART00000144434 None None 102 None 5

The following transcripts of ENSDARG00000025747 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 8660037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACAGTACATCATGTTTTTCCCCTTTTTATCTCCACACAGGGTTTTGGC[A/T]AACAAGTTGATGTTTCTTACATTGCCCAGCATTACAACATGAGCAAAAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/co6xdldh