grin1b

Ensembl ID:
ENSDARG00000025728
ZFIN ID:
ZDB-GENE-051202-2
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1b [Source:RefSeq peptide;Acc:NP_001137603]
Human Orthologue:
GRIN1
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1 [Source:HGNC Symbol;Acc:4584]
Mouse Orthologue:
Grin1
Mouse Description:
glutamate receptor, ionotropic, NMDA1 (zeta 1) Gene [Source:MGI Symbol;Acc:MGI:95819]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6056 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18803 Nonsense Mutation detected in F1 DNA During 2014
sa10811 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Essential Splice Site 208 937 4 21
ENSDART00000121839 None None 899 None 19
Genomic Location:
Chromosome 5 (position 31273590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATGAAAACCTCGACCAACTGTCCTTTGACAACAAGCGAGGACCCAAG[G/A]TATATTTGCATGGTCAATGCACGCCGCCCAAAAAGTTATCTGAAAGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
Genomic Location:
Chromosome 5 (position 31267231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGCATTTACTTATTTTTCCCACTGATAGATTGTAACAATTCATCAA[G/T]AGCCCTTTGTCTACGTGAAGCCGACTTTACGAGATGGAACCTGTAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
Genomic Location:
Chromosome 5 (position 31267231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGNCATTTACTTATTTTTCCCACTGATAGATTGTMACAATTCATCAA[G/T]AGCCCTTTGTCTACGTGAAGCCGACTTTACGAGATGGAACCTGTAAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tmx5cmm2