grin1b

Ensembl ID:
ENSDARG00000025728
ZFIN ID:
ZDB-GENE-051202-2
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1b [Source:RefSeq peptide;Acc:NP_001137603]
Human Orthologue:
GRIN1
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 1 [Source:HGNC Symbol;Acc:4584]
Mouse Orthologue:
Grin1
Mouse Description:
glutamate receptor, ionotropic, NMDA1 (zeta 1) Gene [Source:MGI Symbol;Acc:MGI:95819]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6056 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18803 Nonsense Mutation detected in F1 DNA During 2016
sa10811 Nonsense Available for shipment Available now
sa40455 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Essential Splice Site 208 937 4 21
ENSDART00000121839   None 899 None 19
Genomic Location (Zv9):
Chromosome 5 (position 31273590)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29034947
KASP Assay ID:
554-3921.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTATGAAAACCTCGACCAACTGTCCTTTGACAACAAGCGAGGACCCAAG[G/A]TATATTTGCATGGTCAATGCACGCCGCCCAAAAAGTTATCTGAAAGTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
Genomic Location (Zv9):
Chromosome 5 (position 31267231)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29028588
KASP Assay ID:
2259-5939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTGCATTTACTTATTTTTCCCACTGATAGATTGTAACAATTCATCAA[G/T]AGCCCTTTGTCTACGTGAAGCCGACTTTACGAGATGGAACCTGTAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
ENSDART00000034849 Nonsense 424 937 10 21
ENSDART00000121839 Nonsense 406 899 9 19
Genomic Location (Zv9):
Chromosome 5 (position 31267231)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29028588
KASP Assay ID:
2259-5939.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTGNCATTTACTTATTTTTCCCACTGATAGATTGTMACAATTCATCAA[G/T]AGCCCTTTGTCTACGTGAAGCCGACTTTACGAGATGGAACCTGTAAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034849 Nonsense 760 937 17 21
ENSDART00000121839 Nonsense 742 899 16 19
Genomic Location (Zv9):
Chromosome 5 (position 31252661)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29014018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTATATGGGATTCAGCAGTGTTGGAGTTTGAGGCCTCGCAGAAATG[T/A]GACCTGGTTACTACGGGCGAGCTGTTCTTCCGCTCTGGATTCGGTATCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link