mbd1

Ensembl ID:
ENSDARG00000025699
ZFIN ID:
ZDB-GENE-030131-6318
Description:
methyl-CpG binding domain protein 1 [Source:RefSeq peptide;Acc:NP_001038218]
Human Orthologue:
MBD1
Human Description:
methyl-CpG binding domain protein 1 [Source:HGNC Symbol;Acc:6916]
Mouse Orthologue:
Mbd1
Mouse Description:
methyl-CpG binding domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:1333811]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7223 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21916 Nonsense Available for shipment Available now
sa35091 Nonsense Mutation detected in F1 DNA During 2016
sa3784 Nonsense Mutation detected in F1 DNA During 2016
sa21917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41843 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21918 Nonsense Mutation detected in F1 DNA During 2016
sa31833 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914   None 964 None 16
ENSDART00000035629   None 850 None 15
ENSDART00000124131 Essential Splice Site None 961 None 17
ENSDART00000147179 Essential Splice Site None 66 None 3
Genomic Location:
Chromosome 11 (position 26493724)
KASP Assay ID:
554-4754.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAGTTATTTAAAATTTACCAATGTGTGGCTCGTTAAGGKGTTWACAGG[T/G]AGGKTTTTAAAAATGTCGCCGTCGTATTWATGACTTTTCATGTAACCGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21916
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Nonsense 13 964 1 16
ENSDART00000035629   None 850 None 15
ENSDART00000124131 Nonsense 13 961 2 17
ENSDART00000147179 Nonsense 13 66 3 3
Genomic Location:
Chromosome 11 (position 26494227)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCTATACAACCATGGACACAGAGGAAGTAGCAGCTGAAGCACCTGCA[G/T]AAACAGCAACCGAGGAAAAAGATGCAACTTCAGAGGAAAACAAAGAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Nonsense 523 964 7 16
ENSDART00000035629   None 850 None 15
ENSDART00000124131 Nonsense 523 961 8 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26500056)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAATATCCACTCTCGTAAAGTTGTTAAATGTCGCAAACGGAAATGTT[T/A]ACACCCTGTTCGTAGGGAGAGGGGTTTTAAGGTACAGTGCTATATATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Nonsense 691 964 12 16
ENSDART00000035629 Nonsense 579 850 11 15
ENSDART00000124131 Nonsense 690 961 13 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26505728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGGTCCAAGAAGATGTGGGGTTTTGAGATGTCAGATGATATGCCTGAA[C/T]AGTACATGCAGAAAAATTCAGCTCACCTGATGAATCAAGACCGATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Essential Splice Site 742 964 14 16
ENSDART00000035629 Essential Splice Site 628 850 13 15
ENSDART00000124131 Essential Splice Site 739 961 15 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26506158)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGAACCGAAGCTACTGTATATAAATGTTGATTTGTCATTTTCTCTCTC[T/A]GGAGACGATGAGTCCTCATGTGCGAACTGGACAGGCGGAGATGATCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41843
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Essential Splice Site 772 964 14 16
ENSDART00000035629 Essential Splice Site 658 850 13 15
ENSDART00000124131 Essential Splice Site 769 961 15 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26506254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGAAAATGGGCTTCAGAGCATCAGTAACAGAAGCTTTGTGGCTAGGG[T/C]AAGCTCCTTATAATTTTCTGTGTTTAAATGAATAAAAACAAGAAAGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Nonsense 786 964 15 16
ENSDART00000035629 Nonsense 672 850 14 15
ENSDART00000124131 Nonsense 783 961 16 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26507481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATTTACAGAGACCTGACGTTCCTCCTACCACTCAGTTTGACAGCACT[G/T]GAAATCCAGGCTCTAAAACTGAAAGAAACCGATCGCAGGATGAACAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033914 Essential Splice Site 810 964 None 16
ENSDART00000035629 Essential Splice Site 696 850 None 15
ENSDART00000124131 Essential Splice Site 807 961 None 17
ENSDART00000147179   None 66 None 3
Genomic Location:
Chromosome 11 (position 26508598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATAGGTGGATGGAAACATAGCTAGTGCCCACACTCTTCTTTCTATGAC[A/T]GATCACTCAGATATTCAGCGTGGCAGGCAGCGACCACGCCGTCCAGGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link