comtb

Ensembl ID:
ENSDARG00000025679
ZFIN ID:
ZDB-GENE-040724-164
Description:
catechol O-methyltransferase [Source:RefSeq peptide;Acc:NP_001077312]
Human Orthologue:
COMT
Human Description:
catechol-O-methyltransferase [Source:HGNC Symbol;Acc:2228]
Mouse Orthologue:
Comt1
Mouse Description:
catechol-O-methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:88470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6209 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033702 Nonsense 193 264 5 6
ENSDART00000146647 None None 20 None 3
Genomic Location:
Chromosome 11 (position 26563560)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAKCACTTTGGAATYGAAACCTTTGATTTAGTTTTTCTGGACCACTG[G/A]AAAGACCATTACCTTCCTGACACTAAATTAATGGAGGTGTGTTTTGACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/py3ybq1l