LOC793153

Ensembl ID:
ENSDARG00000025672
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15102 Essential Splice Site Available for shipment Available now
sa38714 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15102
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Essential Splice Site 476 609 18 18
Genomic Location (Zv9):
Chromosome 8 (position 52745413)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50062436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATAAANTATTATTGTTTTCTCTAAATATTTCTCTCTTCTYGTTCCCTC[A/T]GGGCMGCTGTATGAAYTTCACCCGCATCAAGTCCAATCCTCCACCKCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030064 Nonsense 485 609 18 18
Genomic Location (Zv9):
Chromosome 8 (position 52745442)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50062407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTCTCTTCTCGTTCCCTCAGGGCCGCTGTATGAACTTCACCCGCATC[A/T]AGTCCAATCCTCCACCGCGGTATCCATCCTACAACCATCATTCCTCCCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link